Review



mcherry tomm20 n 10  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc mcherry tomm20 n 10
    Mcherry Tomm20 N 10, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+tomm20+n/pGEX-KG-D4H*-mCherry+(Plasmid+%23134604)/pm41933731-193-13-14
    Average 93 stars, based on 8 article reviews
    mcherry tomm20 n 10 - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Construct:

    Article Title: Incorporating a Polyethyleneglycol Linker to Enhance the Hydrophilicity of Mitochondria-Targeted Triphenylphosphonium Constructs.
    Article Snippet: The extraction was diluted with 750 μL of HPLC buffer A and filtered through a 0.20 μm 96-well polyethylene filter plate (ThermoFisher Scientific) before analyzing RP-HPLC by the same condition as mitochondrial uptake. .. Plasmids and constructs: mCherry-TOMM20-N-10 was a gift from Michael Davidson (Addgene plasmid # 55146). pCDH-EF1-copGFPT2A-Puro was a gift from Kazuhiro Oka (Addgene plasmid # 72263). mCherry-TOMM20-N-10 was amplified by mCherry-TOMM20-N-10 by PCR using the forward and reverse primers mChTOMM20F and mChTOMM20R. pCDH-EF1-copGFP-T2A-Puro was linearized by PCR using the forward and reverse primers LinF and LinR thus removing the copGFP fragment. .. The pCDH-mCherry-TOMM20-T2 A-Puro lentiviral vector was created by inserting the mCherry-TOMM20-N10 fragment into the linearized pCDH-EF1-T2A-Puro plasmid with an HD Infusion Cloning kit. mChTOM20F: GCAATTGGATCCACCGCCACCATGGTGGGT mChTOM20R: CTGAGCGCGGGATCTCTTGTACAGCTCGTCCATGCCG LinF: AGATCCCGCGCTCAGT LinR: GGTGGATCCAATTGCTCACG Lentiviral production and transduction: Lentiviral particles for pCDH-mCherry-TOMM20-T2A-Puro were generated in HEK-293T cells via co-transfection of the target vector together with packaging psPAX2 (Addgene, #12260) and envelope pMD2.G (Addgene, #12259) vectors.

    Article Title: p53 loss activates prometastatic secretory vesicle biogenesis in the Golgi
    Article Snippet: BioID-PAQR11 construct was modified from PAQR11-pEGFP-C3 by replacing the EGFP coding sequence with BioID sequence from myc-BioID2-MCS (Addgene plasmid #74223). .. PAQR11 3′UTR luciferase reporters were constructed as previously described ( ). mCherry-TOMM20-N-10 was a gift from M. Davidson (Addgene plasmid #55146). ..

    Plasmid Preparation:

    Article Title: Incorporating a Polyethyleneglycol Linker to Enhance the Hydrophilicity of Mitochondria-Targeted Triphenylphosphonium Constructs.
    Article Snippet: The extraction was diluted with 750 μL of HPLC buffer A and filtered through a 0.20 μm 96-well polyethylene filter plate (ThermoFisher Scientific) before analyzing RP-HPLC by the same condition as mitochondrial uptake. .. Plasmids and constructs: mCherry-TOMM20-N-10 was a gift from Michael Davidson (Addgene plasmid # 55146). pCDH-EF1-copGFPT2A-Puro was a gift from Kazuhiro Oka (Addgene plasmid # 72263). mCherry-TOMM20-N-10 was amplified by mCherry-TOMM20-N-10 by PCR using the forward and reverse primers mChTOMM20F and mChTOMM20R. pCDH-EF1-copGFP-T2A-Puro was linearized by PCR using the forward and reverse primers LinF and LinR thus removing the copGFP fragment. .. The pCDH-mCherry-TOMM20-T2 A-Puro lentiviral vector was created by inserting the mCherry-TOMM20-N10 fragment into the linearized pCDH-EF1-T2A-Puro plasmid with an HD Infusion Cloning kit. mChTOM20F: GCAATTGGATCCACCGCCACCATGGTGGGT mChTOM20R: CTGAGCGCGGGATCTCTTGTACAGCTCGTCCATGCCG LinF: AGATCCCGCGCTCAGT LinR: GGTGGATCCAATTGCTCACG Lentiviral production and transduction: Lentiviral particles for pCDH-mCherry-TOMM20-T2A-Puro were generated in HEK-293T cells via co-transfection of the target vector together with packaging psPAX2 (Addgene, #12260) and envelope pMD2.G (Addgene, #12259) vectors.

    Article Title: In situ cryo-ET visualization of mitochondrial depolarization and mitophagic engulfment
    Article Snippet: Detailed protocols may be found here: dx.doi.org/10.17504/protocols.io.81wgbxq2qlpk/v1 ; dx.doi.org/10.17504/protocols.io.yxmvm3z5bl3p/v1 For live time lapse imaging, U2OS cells were plated on glass-bottom 35 mm dishes (Mattek, P35GC-1.5-14-C) 24 h prior to transient plasmid transfection, and 48 h prior to imaging. .. Plasmid transfection occurred in Opti-MEMTM I Reduced Serum Medium (Thermo Fisher Scientific, REF: 31985-070) with Lipofectamine 2000 reagent (Thermo Fisher Scientific, REF:11668030). mCherry-TOMM20-N-10 was a gift from Michael Davidson (addgene: 55146; RRID:Addgene_55146). .. ATP5F1B-turboGFP was generated via custom synthesis by OriGene, based on NCBI mRNA sequence identifier NM_001686 (SKU: RG201638).

    Article Title: Identification of specific lipid-protein interactions in dividing cells using lipid-trap mass spectrometry
    Article Snippet: .. pCW57-GFP-2A-MCS was a gift from Adam Karpf (Addgene plasmid # 71783), Lact-C2-GFP was a gift from Sergio Grinstein (Addgene plasmid # 22852), mCherry-TOMM20-N-10 was a gift from Michael Davidson (Addgene plasmid # 55146). .. RACGAP1 cDNA was a gift from Prof. Francis Barr . pNG72-CHMP2A-LAP-GFP was a gift from Prof. Juan Martin Serrano . pAG138-BFP-Livedrop and pCMS28-GFP-CHMP4B were a gift from Prof. Jeremy Carlton. pcW57 vector was a tetracycline/doxycycline-inducible lentiviral vector, Tet ON. pcW57-RACGAP1-GFP was created by digesting pcW57 with NheI and BamHI and ligating the GFP insert.

    Article Title: p53 loss activates prometastatic secretory vesicle biogenesis in the Golgi
    Article Snippet: BioID-PAQR11 construct was modified from PAQR11-pEGFP-C3 by replacing the EGFP coding sequence with BioID sequence from myc-BioID2-MCS (Addgene plasmid #74223). .. PAQR11 3′UTR luciferase reporters were constructed as previously described ( ). mCherry-TOMM20-N-10 was a gift from M. Davidson (Addgene plasmid #55146). ..

    Article Title: A genome-wide CRISPR-Cas9 knockout screen reveals FSP1 as warfarin-resistant vitamin K reductase
    Article Snippet: Human Brunello CRISPR knockout 20 pooled library was a gift from David Root and John Doench (Addgene #73178). .. The fluorescent 21 protein-tagged marker of the endoplasmic reticulum (ER) (mCherry-Sec61-N-18), mitochondrial 22 22 (mCherry-TOMM20-N-10), and Golgi apparatus (pmScarlet_Giantin_C1) were gifts from 1 Michael Davidson (Addgene plasmid # 55130 and #55146) and Dorus Gadella (Addgene plasmid 2 # 85048), respectively. .. The sgRNA cloning vector of pX330-U6-Chimeric-BB-CBh-hSpCas9, 3 LentiCRISPR v2, and lentiCas9-Blast were gifts from Feng Zhang (Addgene plasmid # 42230, 4 #52961, and #52962, respectively).

    Article Title: In situ cryo-ET visualization of mitochondrial depolarization and mitophagic engulfment
    Article Snippet: For live time-lapse imaging, U2OS cells were plated on glass-bottom 35 mm dishes (Mattek, P35GC-1.5-14-C) 24 h prior to transient plasmid transfection, and 48 h prior to imaging. .. Plasmid transfection occurred in Opti-MEMTM I Reduced Serum Medium (Thermo Fisher Scientific, REF: 31985-070) with Lipofectamine 2000 reagent (Thermo Fisher Scientific, REF:11668030). mCherry-TOMM20-N-10 was obtained from Addgene (Watertown, MA) (Addgene: 55146). .. ATP5F1B-turboGFP was generated via custom synthesis by OriGene, based on NCBI mRNA sequence identifier NM_001686 (SKU: RG201638, Addgene: 239795).

    Amplification:

    Article Title: Incorporating a Polyethyleneglycol Linker to Enhance the Hydrophilicity of Mitochondria-Targeted Triphenylphosphonium Constructs.
    Article Snippet: The extraction was diluted with 750 μL of HPLC buffer A and filtered through a 0.20 μm 96-well polyethylene filter plate (ThermoFisher Scientific) before analyzing RP-HPLC by the same condition as mitochondrial uptake. .. Plasmids and constructs: mCherry-TOMM20-N-10 was a gift from Michael Davidson (Addgene plasmid # 55146). pCDH-EF1-copGFPT2A-Puro was a gift from Kazuhiro Oka (Addgene plasmid # 72263). mCherry-TOMM20-N-10 was amplified by mCherry-TOMM20-N-10 by PCR using the forward and reverse primers mChTOMM20F and mChTOMM20R. pCDH-EF1-copGFP-T2A-Puro was linearized by PCR using the forward and reverse primers LinF and LinR thus removing the copGFP fragment. .. The pCDH-mCherry-TOMM20-T2 A-Puro lentiviral vector was created by inserting the mCherry-TOMM20-N10 fragment into the linearized pCDH-EF1-T2A-Puro plasmid with an HD Infusion Cloning kit. mChTOM20F: GCAATTGGATCCACCGCCACCATGGTGGGT mChTOM20R: CTGAGCGCGGGATCTCTTGTACAGCTCGTCCATGCCG LinF: AGATCCCGCGCTCAGT LinR: GGTGGATCCAATTGCTCACG Lentiviral production and transduction: Lentiviral particles for pCDH-mCherry-TOMM20-T2A-Puro were generated in HEK-293T cells via co-transfection of the target vector together with packaging psPAX2 (Addgene, #12260) and envelope pMD2.G (Addgene, #12259) vectors.

    Polymerase Chain Reaction:

    Article Title: Incorporating a Polyethyleneglycol Linker to Enhance the Hydrophilicity of Mitochondria-Targeted Triphenylphosphonium Constructs.
    Article Snippet: The extraction was diluted with 750 μL of HPLC buffer A and filtered through a 0.20 μm 96-well polyethylene filter plate (ThermoFisher Scientific) before analyzing RP-HPLC by the same condition as mitochondrial uptake. .. Plasmids and constructs: mCherry-TOMM20-N-10 was a gift from Michael Davidson (Addgene plasmid # 55146). pCDH-EF1-copGFPT2A-Puro was a gift from Kazuhiro Oka (Addgene plasmid # 72263). mCherry-TOMM20-N-10 was amplified by mCherry-TOMM20-N-10 by PCR using the forward and reverse primers mChTOMM20F and mChTOMM20R. pCDH-EF1-copGFP-T2A-Puro was linearized by PCR using the forward and reverse primers LinF and LinR thus removing the copGFP fragment. .. The pCDH-mCherry-TOMM20-T2 A-Puro lentiviral vector was created by inserting the mCherry-TOMM20-N10 fragment into the linearized pCDH-EF1-T2A-Puro plasmid with an HD Infusion Cloning kit. mChTOM20F: GCAATTGGATCCACCGCCACCATGGTGGGT mChTOM20R: CTGAGCGCGGGATCTCTTGTACAGCTCGTCCATGCCG LinF: AGATCCCGCGCTCAGT LinR: GGTGGATCCAATTGCTCACG Lentiviral production and transduction: Lentiviral particles for pCDH-mCherry-TOMM20-T2A-Puro were generated in HEK-293T cells via co-transfection of the target vector together with packaging psPAX2 (Addgene, #12260) and envelope pMD2.G (Addgene, #12259) vectors.

    Transfection:

    Article Title: In situ cryo-ET visualization of mitochondrial depolarization and mitophagic engulfment
    Article Snippet: Detailed protocols may be found here: dx.doi.org/10.17504/protocols.io.81wgbxq2qlpk/v1 ; dx.doi.org/10.17504/protocols.io.yxmvm3z5bl3p/v1 For live time lapse imaging, U2OS cells were plated on glass-bottom 35 mm dishes (Mattek, P35GC-1.5-14-C) 24 h prior to transient plasmid transfection, and 48 h prior to imaging. .. Plasmid transfection occurred in Opti-MEMTM I Reduced Serum Medium (Thermo Fisher Scientific, REF: 31985-070) with Lipofectamine 2000 reagent (Thermo Fisher Scientific, REF:11668030). mCherry-TOMM20-N-10 was a gift from Michael Davidson (addgene: 55146; RRID:Addgene_55146). .. ATP5F1B-turboGFP was generated via custom synthesis by OriGene, based on NCBI mRNA sequence identifier NM_001686 (SKU: RG201638).

    Article Title: In situ cryo-ET visualization of mitochondrial depolarization and mitophagic engulfment
    Article Snippet: For live time-lapse imaging, U2OS cells were plated on glass-bottom 35 mm dishes (Mattek, P35GC-1.5-14-C) 24 h prior to transient plasmid transfection, and 48 h prior to imaging. .. Plasmid transfection occurred in Opti-MEMTM I Reduced Serum Medium (Thermo Fisher Scientific, REF: 31985-070) with Lipofectamine 2000 reagent (Thermo Fisher Scientific, REF:11668030). mCherry-TOMM20-N-10 was obtained from Addgene (Watertown, MA) (Addgene: 55146). .. ATP5F1B-turboGFP was generated via custom synthesis by OriGene, based on NCBI mRNA sequence identifier NM_001686 (SKU: RG201638, Addgene: 239795).

    Luciferase:

    Article Title: p53 loss activates prometastatic secretory vesicle biogenesis in the Golgi
    Article Snippet: BioID-PAQR11 construct was modified from PAQR11-pEGFP-C3 by replacing the EGFP coding sequence with BioID sequence from myc-BioID2-MCS (Addgene plasmid #74223). .. PAQR11 3′UTR luciferase reporters were constructed as previously described ( ). mCherry-TOMM20-N-10 was a gift from M. Davidson (Addgene plasmid #55146). ..

    Marker:

    Article Title: A genome-wide CRISPR-Cas9 knockout screen reveals FSP1 as warfarin-resistant vitamin K reductase
    Article Snippet: Human Brunello CRISPR knockout 20 pooled library was a gift from David Root and John Doench (Addgene #73178). .. The fluorescent 21 protein-tagged marker of the endoplasmic reticulum (ER) (mCherry-Sec61-N-18), mitochondrial 22 22 (mCherry-TOMM20-N-10), and Golgi apparatus (pmScarlet_Giantin_C1) were gifts from 1 Michael Davidson (Addgene plasmid # 55130 and #55146) and Dorus Gadella (Addgene plasmid 2 # 85048), respectively. .. The sgRNA cloning vector of pX330-U6-Chimeric-BB-CBh-hSpCas9, 3 LentiCRISPR v2, and lentiCas9-Blast were gifts from Feng Zhang (Addgene plasmid # 42230, 4 #52961, and #52962, respectively).



    Similar Products

    93
    Addgene inc mcherry tomm20 n 10
    Mcherry Tomm20 N 10, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+tomm20+n/pGEX-KG-D4H*-mCherry+(Plasmid+%23134604)/pm41933731-193-13-14
    Average 93 stars, based on 1 article reviews
    mcherry tomm20 n 10 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pmemerald ergic53
    Pmemerald Ergic53, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+tomm20+n/mCherry-TOMM20-N-10+(Plasmid+%2355146)/pm41933731-193-17-18
    Average 93 stars, based on 1 article reviews
    pmemerald ergic53 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc cloning mcherry tomm20 n 10
    Cloning Mcherry Tomm20 N 10, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+tomm20+n/mCherry-TOMM20-N-10+(Plasmid+%2355146)/pm41759308-656-10-12
    Average 93 stars, based on 1 article reviews
    cloning mcherry tomm20 n 10 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc cmv tomm20 halotag tomm20
    Cmv Tomm20 Halotag Tomm20, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+tomm20+n/mCherry-TOMM20-N-10+(Plasmid+%2355146)/pm41672994-534-117-114
    Average 93 stars, based on 1 article reviews
    cmv tomm20 halotag tomm20 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc michael davidson
    Michael Davidson, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+tomm20+n/mCherry-TOMM20-N-10+(Plasmid+%2355146)/pm41407674-363-7-9
    Average 93 stars, based on 1 article reviews
    michael davidson - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc tom20 coding region
    (A) Immunofluorescence images showing localization of mito-sensors tagged to a YFP (Green) with endogenous <t>TOM20</t> staining (red) and the superposition of both acquisitions with Dapi (blue). (B) Merged images showing localization of mito-sensors tagged to a Nluc (Green) with Mito Tracker Red CMX Ros staining (Red). (C) Schematic representation of localization sensors in different compartments. (D, E) BRET values represent the proximity between Nluc-OMM, TOM20-Nluc, respectively, and localization sensors (YFP), n =5. (F) Schematic representation of mitochondrial protein sensors in different compartments. (G) BRET values represent the proximity between TOM20-Nluc and mitochondrial proteins (YFP), n =4
    Tom20 Coding Region, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+tomm20+n/mCherry-TOMM20-N-10+(Plasmid+%2355146)/bio_rxiv__2025__10__27__684728-132-8-11
    Average 93 stars, based on 1 article reviews
    tom20 coding region - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc michael davidson lab
    (A) Immunofluorescence images showing localization of mito-sensors tagged to a YFP (Green) with endogenous <t>TOM20</t> staining (red) and the superposition of both acquisitions with Dapi (blue). (B) Merged images showing localization of mito-sensors tagged to a Nluc (Green) with Mito Tracker Red CMX Ros staining (Red). (C) Schematic representation of localization sensors in different compartments. (D, E) BRET values represent the proximity between Nluc-OMM, TOM20-Nluc, respectively, and localization sensors (YFP), n =5. (F) Schematic representation of mitochondrial protein sensors in different compartments. (G) BRET values represent the proximity between TOM20-Nluc and mitochondrial proteins (YFP), n =4
    Michael Davidson Lab, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mcherry+tomm20+n/mCherry-TOMM20-N-10+(Plasmid+%2355146)/pmc12593337__ja5c15621_si_001-30-6-9
    Average 93 stars, based on 1 article reviews
    michael davidson lab - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    (A) Immunofluorescence images showing localization of mito-sensors tagged to a YFP (Green) with endogenous TOM20 staining (red) and the superposition of both acquisitions with Dapi (blue). (B) Merged images showing localization of mito-sensors tagged to a Nluc (Green) with Mito Tracker Red CMX Ros staining (Red). (C) Schematic representation of localization sensors in different compartments. (D, E) BRET values represent the proximity between Nluc-OMM, TOM20-Nluc, respectively, and localization sensors (YFP), n =5. (F) Schematic representation of mitochondrial protein sensors in different compartments. (G) BRET values represent the proximity between TOM20-Nluc and mitochondrial proteins (YFP), n =4

    Journal: bioRxiv

    Article Title: BRET-Based Mitochondrial Subcompartment Localization Biosensors

    doi: 10.1101/2025.10.27.684728

    Figure Lengend Snippet: (A) Immunofluorescence images showing localization of mito-sensors tagged to a YFP (Green) with endogenous TOM20 staining (red) and the superposition of both acquisitions with Dapi (blue). (B) Merged images showing localization of mito-sensors tagged to a Nluc (Green) with Mito Tracker Red CMX Ros staining (Red). (C) Schematic representation of localization sensors in different compartments. (D, E) BRET values represent the proximity between Nluc-OMM, TOM20-Nluc, respectively, and localization sensors (YFP), n =5. (F) Schematic representation of mitochondrial protein sensors in different compartments. (G) BRET values represent the proximity between TOM20-Nluc and mitochondrial proteins (YFP), n =4

    Article Snippet: TOM20-YFP(Nluc) fusion proteins were obtained by fusing the TOM20 coding region (Addgene # 55146) in its c-terminus to YFP or Nluc.

    Techniques: Immunofluorescence, Staining

    (A) Immunofluorescence images showing mito-biosensors tagged to a YFP (Green) with endogenous TOM20 staining (red) and the superposition of both acquisitions with Dapi (blue). (B) Images showing colocalization of mito-sensors tagged to Nluc (Green) with Mito Tracker Red CMX Ros staining (Red). (C) Schematic representation of mito-biosensors in different compartments. (D,E,F) BRET values represent the proximity between CLU-Nluc, IBM-Nluc, and MICU1-Nluc, respectively, and localization sensors (YFP), n =5. (G) Schematic representation of the localization of VDAC1 and localization biosensors in different compartments. (H) BRET values representing the proximity between VDAC1-Nluc and loc-sensors (YFP), n = 4.

    Journal: bioRxiv

    Article Title: BRET-Based Mitochondrial Subcompartment Localization Biosensors

    doi: 10.1101/2025.10.27.684728

    Figure Lengend Snippet: (A) Immunofluorescence images showing mito-biosensors tagged to a YFP (Green) with endogenous TOM20 staining (red) and the superposition of both acquisitions with Dapi (blue). (B) Images showing colocalization of mito-sensors tagged to Nluc (Green) with Mito Tracker Red CMX Ros staining (Red). (C) Schematic representation of mito-biosensors in different compartments. (D,E,F) BRET values represent the proximity between CLU-Nluc, IBM-Nluc, and MICU1-Nluc, respectively, and localization sensors (YFP), n =5. (G) Schematic representation of the localization of VDAC1 and localization biosensors in different compartments. (H) BRET values representing the proximity between VDAC1-Nluc and loc-sensors (YFP), n = 4.

    Article Snippet: TOM20-YFP(Nluc) fusion proteins were obtained by fusing the TOM20 coding region (Addgene # 55146) in its c-terminus to YFP or Nluc.

    Techniques: Immunofluorescence, Staining

    (A) Immunofluorescence images showing localization of mito-sensors tagged to a YFP (Green) with endogenous TOM20 staining (red) and the superposition of both acquisitions with Dapi (blue). (B) Merged images showing localization of mito-sensors tagged to a Nluc (Green) with Mito Tracker Red CMX Ros staining (Red). (C) Schematic representation of localization sensors in different compartments. (D, E, F) BRET values represent the proximity between -MX-Nluc, ATP5F1C-Nluc, and OTC-Nluc, respectively, and localization sensors (YFP). n =5. (G) Schematic representation of the localization of the Sirtuins and MX loc-biosensor in different compartments. (G) BRET values represent the proximity between MX-Nluc, MX-YFP, and sirtuins (YFP), n = 4

    Journal: bioRxiv

    Article Title: BRET-Based Mitochondrial Subcompartment Localization Biosensors

    doi: 10.1101/2025.10.27.684728

    Figure Lengend Snippet: (A) Immunofluorescence images showing localization of mito-sensors tagged to a YFP (Green) with endogenous TOM20 staining (red) and the superposition of both acquisitions with Dapi (blue). (B) Merged images showing localization of mito-sensors tagged to a Nluc (Green) with Mito Tracker Red CMX Ros staining (Red). (C) Schematic representation of localization sensors in different compartments. (D, E, F) BRET values represent the proximity between -MX-Nluc, ATP5F1C-Nluc, and OTC-Nluc, respectively, and localization sensors (YFP). n =5. (G) Schematic representation of the localization of the Sirtuins and MX loc-biosensor in different compartments. (G) BRET values represent the proximity between MX-Nluc, MX-YFP, and sirtuins (YFP), n = 4

    Article Snippet: TOM20-YFP(Nluc) fusion proteins were obtained by fusing the TOM20 coding region (Addgene # 55146) in its c-terminus to YFP or Nluc.

    Techniques: Immunofluorescence, Staining